View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_low_76 (Length: 256)
Name: NF16515_low_76
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 2 - 240
Target Start/End: Complemental strand, 43263470 - 43263231
Alignment:
| Q |
2 |
tacagacaataataactcacggaaacctcgcttccaatgtccaatacatccaagttagctccacagtccaagtaacaagcattccagaaacaatttgcan |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43263470 |
tacagacaataataactcacggaaacctcgcttccaatgtccaatacatccaagttagctccacagtccaagtaacaagcattccagaaacaatttgcat |
43263371 |
T |
 |
| Q |
102 |
nnnnnnnnngttttgcatatggactttttt-gaaaggaaacacatgactcgtatctggctttatttcagggcatttcatcaacttgtgcttggataaaca |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43263370 |
tttttttttgttttgcatatggactttttttgaaaggaaacacatgactcgtatctggctttatttcagggcatttcatcaacttgtgcttggataaaca |
43263271 |
T |
 |
| Q |
201 |
gagttcattgatcaacagctagacgtaaccacaacattaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43263270 |
gagttcattgatcaacagctagacgtaaccacaacattaa |
43263231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University