View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_low_90 (Length: 228)
Name: NF16515_low_90
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_low_90 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 148 - 228
Target Start/End: Original strand, 32689404 - 32689484
Alignment:
| Q |
148 |
atatagtatgacggattattatcaccagccatactattacttacgaaannnnnnngctagtgatccgccagaaatgtacat |
228 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
32689404 |
atataatatgacggattattatcaccaaccatactattacttacggaaattttttgctagtgatccgccagaaatgtacat |
32689484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 32689261 - 32689343
Alignment:
| Q |
1 |
actaaactctagtaaaatgttaattcgagccgatttcaaggcnnnnnnnnngcctattttcaacacaatgctaatttttcacttctt |
87 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32689261 |
actaaactctagtaaaatgctaattcgagccgattttaag----tttttttgcctattttcaacacaatgctaatttttcacttctt |
32689343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University