View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16516_low_26 (Length: 285)
Name: NF16516_low_26
Description: NF16516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16516_low_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 766331 - 766617
Alignment:
| Q |
1 |
agttaattttcttatttccattcataaatctataaccaagtacaatgttccatttttattgtactagtttgtaacaatctaggtagtatctaaattctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
766331 |
agttaattttcttatttccattcataaatctataaccaagtacaatgttccatttttattctacttgtttgtaacaatctaggtagtatctaaattttag |
766430 |
T |
 |
| Q |
101 |
attgaagatgtgttgggtgtctttca--------acacgatgatatgattgcattcaatcgattattttatttcaaaaattagtattcatgtgtatgtgt |
192 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
766431 |
attgaagatgtgttgggtgtctttcacgaaacacacacgaagatatgattgcattcaatcgattattttattttaaaaattagtattcatgtgtat---- |
766526 |
T |
 |
| Q |
193 |
tagtgttagtggtccgtgtcaattttttgtgcttcatatatagaatttggattatctgcgatggacaatctcacacaatcatttatttgttat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
766527 |
--gtgttagtggtccgtgtcaattttttgtgcttcatatatagaatttggattatctgcgatggacaatctcacacaatcatttatttgttat |
766617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University