View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16516_low_27 (Length: 256)
Name: NF16516_low_27
Description: NF16516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16516_low_27 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 11193510 - 11193750
Alignment:
| Q |
16 |
atgcagtatacaacaactataagattctgttaaccattatatatgtccttggggacaaacaagtgagtaattttccgtgactgaaatgagttgcttgatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193510 |
atgcagtatacaacaactataagattctgttaaccattatatatgtccttggggacaaacaagtgagtaattttccgtgactgaaatgagttgcttgatg |
11193609 |
T |
|
| Q |
116 |
nnnnnnngttatatacccatatacatatgaagataggtgagagcatgcgatacatcaattgcaatgtctagacgagcagcgaggtccagaacgtttccat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11193610 |
aaaaaaagttatatacccatatacatatgaagataggtgagagcatgcgatacatcaattgcaatgtctagacgagcagcaaggtccagaacgtttccat |
11193709 |
T |
|
| Q |
216 |
gaatgcctgcaacgatcctttgattaagtagtaggcacaaa |
256 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11193710 |
gaatgcctgtaacgatcctttgattaagtagtaggcacaaa |
11193750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University