View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16516_low_35 (Length: 214)
Name: NF16516_low_35
Description: NF16516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16516_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 13 - 177
Target Start/End: Complemental strand, 51229053 - 51228893
Alignment:
| Q |
13 |
ccaagaaaatctctttgatgtcatcatcttaaaagaaatatgaaaatatatcagtttattgtaagagatatatgtatagatgaattataatgaatcactc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51229053 |
ccaacaaaatctctttgatgtcatcatcttaaaagaaatatgaaaatatatcagtttattgtaaga----tatgtatagatgaattataatgaatcactc |
51228958 |
T |
|
| Q |
113 |
acacacatgtacaaacaaagaaagttggtaccttggctttcatggattagtcccaccattcacaa |
177 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51228957 |
acacacctgtacaaacaaagaaagttggtaccttggctttcatggattagtcccaccattcacaa |
51228893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University