View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16517_high_13 (Length: 312)
Name: NF16517_high_13
Description: NF16517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16517_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 36 - 166
Target Start/End: Complemental strand, 37790081 - 37789942
Alignment:
| Q |
36 |
acgacgacaaaggaaaggggacacggaccgttgccttttctttggggtttcagttcaatccacaaaaacgaggaagcaagttaacttaga---------a |
126 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37790081 |
acgacgacaaaggtaatgggacacggaccgttgccttttctttggggtttcagttcaatccacaaaaacgaggaagcaagttaacttagaaggcgaagca |
37789982 |
T |
|
| Q |
127 |
gttgtcgtttgtggaagaagatgaaaacaagaggtaaaca |
166 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37789981 |
gttgtcgtttgtggaagaagaagaaaacaagaggtaaaca |
37789942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 230 - 296
Target Start/End: Complemental strand, 37789878 - 37789812
Alignment:
| Q |
230 |
gcagctgcttcctatggcatatagaaatcccaatagtttattactgaagtctgcatgttgtggttcc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37789878 |
gcagctgcttcctatggcatatagaaatcccaatagtttattactgaagtctgcatgttgtagttcc |
37789812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 230 - 289
Target Start/End: Complemental strand, 37800718 - 37800659
Alignment:
| Q |
230 |
gcagctgcttcctatggcatatagaaatcccaatagtttattactgaagtctgcatgttg |
289 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
37800718 |
gcagctgcttcctatagcacatagaacgcccaatagtttattactaaagtctgcatgttg |
37800659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University