View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16517_high_3 (Length: 431)
Name: NF16517_high_3
Description: NF16517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16517_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 34 - 142
Target Start/End: Original strand, 34900071 - 34900180
Alignment:
| Q |
34 |
aaaaataaaacaaataataaaaacttactagacnnnnnnnnn-tccaaagtacatgaagaacaaaatttcaaatataaaatttattaaagtaatgcacca |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
34900071 |
aaaaataaaacaaataataaaaacttactagacaaaaaaaaaatccaaagtacatgaagaacaaaatttcaaatataaaatttattgaagtattgcacca |
34900170 |
T |
 |
| Q |
133 |
ccatagtttt |
142 |
Q |
| |
|
|||||||||| |
|
|
| T |
34900171 |
ccatagtttt |
34900180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University