View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16517_low_18 (Length: 347)
Name: NF16517_low_18
Description: NF16517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16517_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 120 - 341
Target Start/End: Complemental strand, 33628575 - 33628356
Alignment:
| Q |
120 |
tgacaaatcaacatttgaatcatagtttagagggtattcatatgtagcgtctcacaagactcgaatagaatttcttcctatgaatctatagaagnnnnnn |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33628575 |
tgacaaatcaacatttgaatcatagtttagagggtatttatatttagcgtctcacaagactcgaatagaatttcttcctatgaacctatagaa-aaaaaa |
33628477 |
T |
|
| Q |
220 |
nnttcaaacgtaaaagcaagtttaatgtagcctttctccaaatttttattcaaattcgattgaccaaacnnnnnnnnnnnttacaacttacacaaatatt |
319 |
Q |
| |
|
||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
33628476 |
aattcaaacctaaaagcaagtttaatgtggcctatctccaaatttttattcaaattcgattgaccaaac-aaaaaaaaaattacaactcacacaaatatt |
33628378 |
T |
|
| Q |
320 |
tggagcttaacccctttgctac |
341 |
Q |
| |
|
||||||||| ||||||| |||| |
|
|
| T |
33628377 |
tggagcttagccccttttctac |
33628356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 33628651 - 33628593
Alignment:
| Q |
19 |
aaaggatttaggtctaccggaaattaatggagataaactttcataacttgaggaatcaa |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33628651 |
aaaggatttaggtctaccggaaattaatggagataaactttcataacttgaggaatcaa |
33628593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University