View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16517_low_28 (Length: 238)
Name: NF16517_low_28
Description: NF16517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16517_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 32126421 - 32126632
Alignment:
| Q |
17 |
agaatcagtatctcatttcaatcagtttgaactttgaatgtctggttgccagcggtcgaacatttgtgaagagagttagcatggtttggtatgtgcatgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32126421 |
agaatcagtatctcatttcaatcagtttgaactttgaatgtctggttgccagcggtcgaacatttgtgaagagagttagcatggtttggtatgtgtatgt |
32126520 |
T |
|
| Q |
117 |
gtggacaatttgtaaaacaagaaatggaaaattcttctaaaataaggaaattgacacagaacaagatggttgagcataaaatcaaagagagcctgtctgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32126521 |
gtggacaatttgtaaaacaagaaatggaaaattcttctaaaataaggaaattgacatagaacaagatggttgagcataaaatcaaagagagcctgtctgg |
32126620 |
T |
|
| Q |
217 |
atagtgcctttg |
228 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
32126621 |
atagtgtctttg |
32126632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University