View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16517_low_29 (Length: 236)
Name: NF16517_low_29
Description: NF16517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16517_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 7463514 - 7463723
Alignment:
| Q |
14 |
cctaggttgtcgctttttaaattaatttcactatattgttgctaattttgttataggnnnnnnnttgtttcgtattcgtatttttgttaaataatgttgt |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7463514 |
cctaggttgtcactttttaaattaatttcactatattgttgctaattttgtaataggaaaaaaattgtttcgtattcgtatttttgttaaataatgttgt |
7463613 |
T |
 |
| Q |
114 |
tttcacatgagcaaagctccttgcaaattttcacgtgcatatactcgtatgaaacttcatttaaatacactaatga---gttaaatcaactaaactaaac |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7463614 |
tttcacatgggcaaagctccttgcaaattttcacgtgcatatactcgtatgaaacttcatttaaatacactaatgaattgttaaatcaactaaactaaac |
7463713 |
T |
 |
| Q |
211 |
tgttttcaca |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
7463714 |
tgttttcaca |
7463723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University