View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16517_low_8 (Length: 431)

Name: NF16517_low_8
Description: NF16517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16517_low_8
NF16517_low_8
[»] chr6 (1 HSPs)
chr6 (34-142)||(34900071-34900180)


Alignment Details
Target: chr6 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 34 - 142
Target Start/End: Original strand, 34900071 - 34900180
Alignment:
34 aaaaataaaacaaataataaaaacttactagacnnnnnnnnn-tccaaagtacatgaagaacaaaatttcaaatataaaatttattaaagtaatgcacca 132  Q
    |||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||    
34900071 aaaaataaaacaaataataaaaacttactagacaaaaaaaaaatccaaagtacatgaagaacaaaatttcaaatataaaatttattgaagtattgcacca 34900170  T
133 ccatagtttt 142  Q
    ||||||||||    
34900171 ccatagtttt 34900180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University