View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16519_low_6 (Length: 337)
Name: NF16519_low_6
Description: NF16519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16519_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 42 - 329
Target Start/End: Complemental strand, 45230588 - 45230301
Alignment:
| Q |
42 |
ataatggaaaactgcacagtgatccccttaaaactaaaactactactgcactacccaaatcatctaaccctcctcctaccatttcggatggtgattggac |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45230588 |
ataatggaaaactgcacagtgatccccttaaaactaaaactactactgcactacccaaatcatctaaccctcctcctaccatttcagatggtgattggac |
45230489 |
T |
|
| Q |
142 |
tcaacttcttagttcaccttctgcttctaacgctttgcctgcacctcgtattttaaggcaaaatagtaagaaactcaatagtttatccgtttctgatatc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45230488 |
tcaacttcttagttcaccttctgcttctaactctttgcctgcacctcgtattttaaggcaaaatagtaagaaactcaatagtttatccgtttctgatatc |
45230389 |
T |
|
| Q |
242 |
aagaggaatcacaaaacttcttcaacatctttgcagaggttagactctcttaaaggagataattttatttccaaatctagtgatgatg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45230388 |
aagaggaatcacaaaacttcttcaacatctttgcagaggttagactctcttaaaggagataattttattgccaaatctagtgatgatg |
45230301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University