View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16520_high_6 (Length: 234)
Name: NF16520_high_6
Description: NF16520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16520_high_6 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0014 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 91083 - 91283
Alignment:
| Q |
16 |
aatatcgtgtgtgccatcgtagaaatcaaggatggtgcaatgtcaaacgattctgaaattcaccccatctgaccatgagttttgcaagttcaaatttgga |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
91083 |
aatattgtgtgtgccatcgtagaaatcaagggatgtgcaatgtcaaacgactctgaaattcaccccagctgaccatgagttttgcaagttcaaatttgga |
91182 |
T |
|
| Q |
116 |
agaaaactctgcgataatatttggaacagtttcatcatcgaagctatagtgcaatgattcttttgttgttggaaatgccatgtaccttgagaagtgacaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91183 |
agaaaactctgcgataatatttggaacagtttcatcatcgaagctatagtgcaatgattcctttgttgttggaaatgccatgtaccttgagaagtgacaa |
91282 |
T |
|
| Q |
216 |
g |
216 |
Q |
| |
|
| |
|
|
| T |
91283 |
g |
91283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 140 - 211
Target Start/End: Complemental strand, 6640290 - 6640219
Alignment:
| Q |
140 |
aacagtttcatcatcgaagctatagtgcaatgattcttttgttgttggaaatgccatgtaccttgagaagtg |
211 |
Q |
| |
|
||||||||||||||| || ||||| |||||| |||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
6640290 |
aacagtttcatcatctaaactatattgcaataattcctttgttgttggaaatgccatataccttgaaaagtg |
6640219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 107
Target Start/End: Complemental strand, 6640375 - 6640298
Alignment:
| Q |
31 |
atcgtagaaatcaagg-atggtgcaatgtcaaacgattctgaaattcaccccatctgaccatgagttttgcaagttca |
107 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||| |||||| ||||||||||| || |||||| |||||||||||||| |
|
|
| T |
6640375 |
atcgtagaaatcaagggatagtgcaatctcaaacaattctggaattcaccccaacttaccatgtgttttgcaagttca |
6640298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University