View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16520_low_14 (Length: 227)
Name: NF16520_low_14
Description: NF16520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16520_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 33753284 - 33753071
Alignment:
| Q |
1 |
gtggttcattttcttcgacatccttattttttgacatgtattttaacatctcannnnnnnnngttatctcttttcttactatcacataacaaatatatta |
100 |
Q |
| |
|
||||||||| || || ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
33753284 |
gtggttcatatttttagacatccttattttttgacatgtattttaacatctcatttttttt-gttatctcttttcctaccatcacatgacaaatatatta |
33753186 |
T |
 |
| Q |
101 |
aatttacaacaacattctttctatttctcccactctcaatatctcaatcgagtgtttggatgttcatgaaacatttttcaacacaattcaacttttcgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33753185 |
aatttacaacaacattctttctatttctcccactctcaatatctcaatcgagtgtttggatgttcatgaaacatttttcaacacaattcaacttttcgtt |
33753086 |
T |
 |
| Q |
201 |
ttgaaattcatctct |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33753085 |
ttgaaattcatctct |
33753071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University