View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16520_low_4 (Length: 328)

Name: NF16520_low_4
Description: NF16520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16520_low_4
NF16520_low_4
[»] chr5 (2 HSPs)
chr5 (81-328)||(39471054-39471301)
chr5 (124-169)||(39464853-39464898)


Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 81 - 328
Target Start/End: Original strand, 39471054 - 39471301
Alignment:
81 cctttctttaggaacaggaatagatgaattcgtgtagagatttagtatcataataaaagaaatctttgtgagtgatgtcatggctttgcgggatggcatg 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
39471054 cctttctttaggaacaggaatagatgaattcgtgtagagatttagtatcataataaaagaaacctttgtgagtgatgtcatggctttgcgggatggcatg 39471153  T
181 atatgagaactttatggcatgagattgaaatgtttgtctttatattatttatgggagaattgatggatggtgaaggctatttactactaccttatatatg 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39471154 atatgagaactttatggcatgagattgaaatgtttgtctttatattatttatgggagaattgatggatggtgaaggctatttactactaccttatatatg 39471253  T
281 gaccgtgcaagtttttgtggtgtacaagaatatgtaaaaactatctga 328  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
39471254 gaccgtgcaagtttttgtggtgtacaagaatatgtaaaaactatctga 39471301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 39464853 - 39464898
Alignment:
124 agtatcataataaaagaaatctttgtgagtgatgtcatggctttgc 169  Q
    ||||||||||||| || |||||||||||||||||||||||||||||    
39464853 agtatcataataagaggaatctttgtgagtgatgtcatggctttgc 39464898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University