View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16520_low_4 (Length: 328)
Name: NF16520_low_4
Description: NF16520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16520_low_4 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 81 - 328
Target Start/End: Original strand, 39471054 - 39471301
Alignment:
| Q |
81 |
cctttctttaggaacaggaatagatgaattcgtgtagagatttagtatcataataaaagaaatctttgtgagtgatgtcatggctttgcgggatggcatg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39471054 |
cctttctttaggaacaggaatagatgaattcgtgtagagatttagtatcataataaaagaaacctttgtgagtgatgtcatggctttgcgggatggcatg |
39471153 |
T |
 |
| Q |
181 |
atatgagaactttatggcatgagattgaaatgtttgtctttatattatttatgggagaattgatggatggtgaaggctatttactactaccttatatatg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39471154 |
atatgagaactttatggcatgagattgaaatgtttgtctttatattatttatgggagaattgatggatggtgaaggctatttactactaccttatatatg |
39471253 |
T |
 |
| Q |
281 |
gaccgtgcaagtttttgtggtgtacaagaatatgtaaaaactatctga |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39471254 |
gaccgtgcaagtttttgtggtgtacaagaatatgtaaaaactatctga |
39471301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 39464853 - 39464898
Alignment:
| Q |
124 |
agtatcataataaaagaaatctttgtgagtgatgtcatggctttgc |
169 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
39464853 |
agtatcataataagaggaatctttgtgagtgatgtcatggctttgc |
39464898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University