View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_high_27 (Length: 454)
Name: NF16521_high_27
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 202 - 276
Target Start/End: Original strand, 24629715 - 24629789
Alignment:
| Q |
202 |
aacagacgggcgctcatgaattagggtttggtaaaatttaagagtgaatttggttgcagagtgtatatgcgtgtc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24629715 |
aacagacgggcgctcatgaattagggtttggtaaaatttaagagtgaatttggttgcagagtgtatatgcgtgtc |
24629789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 368 - 416
Target Start/End: Original strand, 24629797 - 24629845
Alignment:
| Q |
368 |
aaaatcataatgatcctttctatgccaattaaagttgaatttgttggta |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24629797 |
aaaatcataatgatcctttctatgccaattaaagttgactttgttggta |
24629845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 14291991 - 14291950
Alignment:
| Q |
1 |
atttagattataatcttttggcaacatgttgtggaggaattc |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14291991 |
atttagattataatcttttggcaacatgttgtggaggaattc |
14291950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 202 - 276
Target Start/End: Complemental strand, 11032016 - 11031949
Alignment:
| Q |
202 |
aacagacgggcgctcatgaattagggtttggtaaaatttaagagtgaatttggttgcagagtgtatatgcgtgtc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11032016 |
aacagacgggcgctcatgaattagggtttggtaa-------gagtgaatttggttgcagagtgtatatgcgtgtc |
11031949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 416
Target Start/End: Complemental strand, 11031867 - 11031820
Alignment:
| Q |
369 |
aaatcataatgatcctttctatgccaattaaagttgaatttgttggta |
416 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
11031867 |
aaatcagaatgatcttttctatgccaattaaagttgactttgttggta |
11031820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 23879582 - 23879623
Alignment:
| Q |
1 |
atttagattataatcttttggcaacatgttgtggaggaattc |
42 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23879582 |
atttagattataatattttggcaacatgttgtggaggaattc |
23879623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 121 - 173
Target Start/End: Complemental strand, 16187369 - 16187317
Alignment:
| Q |
121 |
tgttagcaagaatgtccgcacaatgatttcctttcctgtatatatgagtaaca |
173 |
Q |
| |
|
||||||||||| |||| ||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
16187369 |
tgttagcaagactgtctgcacattgatttccttccctatatatatgagtaaca |
16187317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University