View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_high_56 (Length: 305)
Name: NF16521_high_56
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_high_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 40 - 300
Target Start/End: Complemental strand, 25742871 - 25742613
Alignment:
| Q |
40 |
tgaacattttagctatgtggattcagaaaaggccaagttgaatgaaaaggaacttcttgaaaagttacttttggaatggagtgagaatgctgatactgac |
139 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
25742871 |
tgaacatgttagctatgtggattcagaaaaggccaagttgaatgaaaaggaacttcttgaaaagttaattttggaatggggtgagaatgctgatactgac |
25742772 |
T |
 |
| Q |
140 |
aattcacaacaagaaaaagacatactagacaggttacagccccatacaaatattaaagagctttctatacataactacctagggacggaatttcctagtt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
25742771 |
aattcacaacaagaaaaagacatactagacaggttacagccccatacaaatctt--agagctttctatacataactacctagggacagaatttcctaatt |
25742674 |
T |
 |
| Q |
240 |
gggtcggagactcttccttctacaacttgttgttcatggagctccagggtagcaaatattg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25742673 |
gggtcggagactcttccttctacaacttgttgttcatggagctccagggtagcaaatattg |
25742613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University