View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_high_85 (Length: 215)
Name: NF16521_high_85
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_high_85 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 55695243 - 55695029
Alignment:
| Q |
1 |
gctgatacttcctctttcacttcgactttttcaggttccgggttctctacctctggcttggcttcctgggttacttgtgtactctcagcttcaacgggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55695243 |
gctgatacttcctctttcacttcgactttttcaggttccgggttctctacctctggcttggcttcctgggttacttgtgtactctcagcttcaacgggaa |
55695144 |
T |
 |
| Q |
101 |
cttcagtttctttattctccactgctactacttcttcggtggtggctggttctgaagcaggaacctcggaggccggtggtgttgtttcctcgaccttggt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55695143 |
cttcagtttcttcattctccactgctactacttcttcggtggtggctggttctgaagcaggaacctcggaggccggtggtgttgtttcctcgaccttggt |
55695044 |
T |
 |
| Q |
201 |
tacctcaactgtttc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
55695043 |
tacctcaactgtttc |
55695029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University