View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_15 (Length: 543)
Name: NF16521_low_15
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 489; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 489; E-Value: 0
Query Start/End: Original strand, 17 - 525
Target Start/End: Original strand, 4614986 - 4615494
Alignment:
| Q |
17 |
gatgaacggtgcagtggaggttaaacgacctaagaacgcgagtgtttcagttttcgagtttggttcggttgctgcgagcaacgataaggttactcttgcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614986 |
gatgaacggtgcagtggaggttaaacgacctaagaacgcgagtgtttcagttttcgagtttggttcggttgctgcgagcaacgataaggttactcttgcc |
4615085 |
T |
 |
| Q |
117 |
ggttattgtccagtttctgaagatcttgagccttgccgttgggagatcctaccggcggttgagtcaaacgcgccgcagtttcgcgttgttttctgatatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615086 |
ggttattgtccagtttctgaagatcttgagccttgccgttgggagatcctaccggcggttgagtcaaacgcgccgcagtttcgcgttgttttctgatatc |
4615185 |
T |
 |
| Q |
217 |
tcatgttatgtgtattcttgtttagttttgcgaactatttatttgaacccaaattgatgatgtacttttatatatgaacgaactgtgttttctctgttcc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615186 |
tcatgttatgtgtattcttgtttagttttgcgaactatttatttgaaccgaaattgatgatgtacttttatatatgaacgaactgtgttttctctgttcc |
4615285 |
T |
 |
| Q |
317 |
atttatttatcccaattcattatatgttccagtaattaggtaattgttcattattatttaatttaattcagtaccattacttttatcagcaacaataaaa |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615286 |
atttatttatcccaattcattatatgttccagtaattagataattgttcattattatttaatttaattcagtaccattacttttatcagcaacaataaaa |
4615385 |
T |
 |
| Q |
417 |
aatctagtttatgtgttactactgatggttatatgagatgtgtgtaaaattgaagttggatatgagataattttttgtaaaattgggagcaatgtaagat |
516 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615386 |
aatctagtttatgtgttactactgatggttatatgagatgtgtgtggaattgaagttggatatgagataattttttgtaaaattgggagcaatgtaagat |
4615485 |
T |
 |
| Q |
517 |
gctcattct |
525 |
Q |
| |
|
|||||||| |
|
|
| T |
4615486 |
actcattct |
4615494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University