View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_23 (Length: 467)
Name: NF16521_low_23
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 9e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 2693991 - 2694108
Alignment:
| Q |
17 |
cttttgacctacggtgattttgttcactccaatttacccagatgctaaccaaataatatgcattgtagtgcgc--annnnnnnagaaaccccgcttagca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
2693991 |
cttttgacctacggtgattttgttcactccaaattacccagatgctaaccaaataatatgcattgtagtgcgcatatttttttagaaaccccgcttagca |
2694090 |
T |
|
| Q |
115 |
aactaaaacacagagcat |
132 |
Q |
| |
|
|||||| |||| |||||| |
|
|
| T |
2694091 |
aactaatacacggagcat |
2694108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University