View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_54 (Length: 335)
Name: NF16521_low_54
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 95 - 314
Target Start/End: Complemental strand, 42801497 - 42801278
Alignment:
| Q |
95 |
aatactgcagtgtaatcaatatttcggatcccctcaaaattaccaatttaattaatttagtacacgaacattctaatcagccacaatcattgttgtggga |
194 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42801497 |
aatactgcaatataatcaatatttcggatcccctcaaaattaccaatttaattaatttagtacacgaacattctaatcagccacaatcattgctgtggga |
42801398 |
T |
|
| Q |
195 |
gttttttccacacgaatggtggtgattgatgtgaaaatgaaatatttttcttatctcatagtagtatcgtacttgcccaattggtgattgctcataaatc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
42801397 |
gttttttccacacgaatggtggtgattgatgtgaaaatgaaatatttttcttatctcatagtagtatagtacttgcccaattgatgattgctcttaaatt |
42801298 |
T |
|
| Q |
295 |
agtcaatcacataaacacga |
314 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
42801297 |
agtcgatcacataaacacga |
42801278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 42801557 - 42801498
Alignment:
| Q |
1 |
cagataattcctataatattttgatacaatttgttctcttaatctcttgtattcgaatgt |
60 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42801557 |
cagataattcctatgatattgtgatacaatttgttctcttaatctcttgtattcgaatgt |
42801498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University