View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_60 (Length: 295)
Name: NF16521_low_60
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 287
Target Start/End: Original strand, 38365005 - 38365274
Alignment:
| Q |
18 |
gtagtttgatgatgtttccaatggagaagaaagctttggattgtcttggtaaaggttttgatctaacaagtgattttagaatgaaatttgctaagggatt |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38365005 |
gtagttcgatgatgtttccaatggagaagagagctttggattgtcttggtaaaggttttgatctaacaagtgattttagaatgaaattttctaagggatt |
38365104 |
T |
 |
| Q |
118 |
aattaatggtggaagattagtggtaattgatgaaatgaacaagagagatattatggtaccaggtggtgttactattaaagatgtttcagaagatattcgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38365105 |
aattaatggtggaagattagtggtaattgatgaaatgaacaagagagatattatggtaccaggtggtgttactattaaagatgtttcagaagatattcgt |
38365204 |
T |
 |
| Q |
218 |
tgtgacaaaggtgatcgtgtgaggttcaaatctgatgttcttccattcaatcaggtttgctcttcttttc |
287 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38365205 |
tgtgacaaaggtgatcgtgtgaggtttaaatctgatgttcttcaattcaatcaggtttgctcttcttttc |
38365274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University