View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_61 (Length: 293)
Name: NF16521_low_61
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 16 - 277
Target Start/End: Original strand, 3852376 - 3852637
Alignment:
| Q |
16 |
atcagaaagaacactaggatcattttcttatgatgaaggtggcaagttgagatcgaaaaaacatagcttcttcttcttcttccaagatggataaaggtga |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852376 |
atcagaaagaacactaggatcaacttcttatgatgaaggtggcaagttgagatcgaaaaaacatagcttcttcttcttcttccaagatggataaaggtga |
3852475 |
T |
 |
| Q |
116 |
gattttttgtgaccacctaatgcttgataagaaccaaaaaccttaggacaaaacacacattggaatattttatgatcactactactagttaaggcaagat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3852476 |
gattttttgtgaccacctaatgcttgataagaaccaaaaaccttaggacaaaacacacattggaatattttatgatcactactactagttaaagcaagat |
3852575 |
T |
 |
| Q |
216 |
ttgtttcattttgaagacaaatgcttttgtgacttttaaacttcccacaaacttcttgttct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3852576 |
ttgtttcattttgaagacaaatgcttttgtgacttttatacttcccacaaacttcttgttct |
3852637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University