View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_63 (Length: 287)
Name: NF16521_low_63
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_63 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 145 - 287
Target Start/End: Complemental strand, 44552773 - 44552631
Alignment:
| Q |
145 |
tctccattttttcatcttatttcatctcttattgttcatcttgatgatcatgttcatcaatcttcttcaaagaaacccaggtaaaaacacttgcaccttc |
244 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
44552773 |
tctccattttttcatcttattccatctcttattgttcatcttgatgatcatgttcatcaatcttcttcaaagaaccccaggtaaaaacacttacaccttc |
44552674 |
T |
|
| Q |
245 |
ttcgtaatttctttccacaacttatcacataagtttcaatttc |
287 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
44552673 |
ttcgtaatttatttccacaacttatcacataaggctcaatttc |
44552631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 44552905 - 44552861
Alignment:
| Q |
19 |
agggtcgtgatgttttcgctaaaagaaaattcgctagattcttct |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44552905 |
agggtcgtgatgttttcgctaaaagaaaattcgctagattcttct |
44552861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University