View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_70 (Length: 266)
Name: NF16521_low_70
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 44370715 - 44370476
Alignment:
| Q |
17 |
ctttgctctgctatgttctgagttggaagttgtgtgatgagacagagagtcaatgaaatggttatgttttataggagagtgttagaaagaattaagacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44370715 |
ctttgctctgctatgttctgagttggaagttgtgtgatgagacaaagagtcaatgaaatggttatgttttataggagagtgttagaaagaattaagacac |
44370616 |
T |
 |
| Q |
117 |
gtgcgtgcg----atggccaagttggaggtcgtatctatttaattttcatttgactgcagacaccatgtggcattaactgagtggtgtatggcacgtgtg |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44370615 |
gtgcgtgcgtgcgatggccaagttggaggtcgtatctatttaattttcatttgactgcagacaccatgtggcattaactgagtggtgtatggcacgtgtg |
44370516 |
T |
 |
| Q |
213 |
agtgttcacccattttagtgattctgtcattgcttacgtt |
252 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44370515 |
agtgttcacgcattttagtgattctgtcattgcttacgtt |
44370476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University