View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_71 (Length: 260)
Name: NF16521_low_71
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_71 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 55 - 242
Target Start/End: Complemental strand, 41997313 - 41997126
Alignment:
| Q |
55 |
ttaacttcgtccaattattgtattttttggatttaattttcttctgagttgcaattgaaacacatatgatgagagatccccaaggagaattcgagagaga |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
41997313 |
ttaacttcgtccaattattgtattttttggatttaattttcttctgagttgcaattgaaacacatttgatgagagatctccaaggagaattcgagagaga |
41997214 |
T |
|
| Q |
155 |
atttttcttcaatttttcgggaattcatttgattgaaactttttaatggagcaacaaaagcttttaattagtaaggaatgttcagttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41997213 |
atttttcttcaatttttcgggaattcattttattgaaactttttaatggagcaacaaaagcttttaattagtaaggattgttcagttt |
41997126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University