View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_95 (Length: 212)
Name: NF16521_low_95
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_95 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 77 - 210
Target Start/End: Complemental strand, 9793725 - 9793592
Alignment:
| Q |
77 |
ctagtttaggatgtcctttaaaaaggcatctaagtacaaaggatactaagcatataagggaagctgtgtctaagcattgaaggatgtcctttaccccctg |
176 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9793725 |
ctagtctaggatgtcctttacaaaggcatctaagtacaaaggatactaagcatagaagggaagctgtgtctaagcattgaaggatgtcctttaccccctg |
9793626 |
T |
 |
| Q |
177 |
tcatccatactaatcaccattgcagttgcctatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
9793625 |
tcatccatactaatcaccattgcagttggctatg |
9793592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 9794079 - 9794022
Alignment:
| Q |
19 |
agcaagtcatagtcaatttaagttcatattttcttgtgattttatacatgttagttag |
76 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9794079 |
agcaattcatagtcaatttaagttcatattttactgtgattttatacatgttagttag |
9794022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 83 - 149
Target Start/End: Original strand, 45161314 - 45161380
Alignment:
| Q |
83 |
taggatgtcctttaaaaaggcatctaagtacaaaggatactaagcatataagggaagctgtgtctaa |
149 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45161314 |
taggatgtcctttacaaaggcatctaagtacaaaggatactaagcatagaagggaagctgtgtctaa |
45161380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 45146956 - 45147013
Alignment:
| Q |
19 |
agcaagtcatagtcaatttaagttcatattttcttgtgattttatacatgttagttag |
76 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45146956 |
agcaaatcatagtcaatttaagttcatattttactgtgattttatacatgttagttag |
45147013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 167 - 210
Target Start/End: Original strand, 45161461 - 45161504
Alignment:
| Q |
167 |
ttaccccctgtcatccatactaatcaccattgcagttgcctatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45161461 |
ttaccccctgtcatccatactaatcaccattgcagttggctatg |
45161504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University