View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16521_low_99 (Length: 208)
Name: NF16521_low_99
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16521_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 193
Target Start/End: Complemental strand, 33419213 - 33419027
Alignment:
| Q |
7 |
ggattgactccgcaaacgagtggcggagactggtcggagcttgaggccggtgtatggaggaaacgtggcagtgctccggcgagaagaggcgacgatagga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33419213 |
ggattgactccgcaaacgagtggcggagactggtcggagcttgaggccggtgtatggaggaaacgtggcagtgctccggcgagaagaagcgacgatagga |
33419114 |
T |
 |
| Q |
107 |
gagcgaataagggagaaggattcgagttgtacggtggccatgattgcagaaaatcgtagctctggaaaagggtgtgaaatgtgttgc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33419113 |
gagcgaataagggagaaggattcgagttgtacggtggccatgattgcagagaatcgtagctctggaaaagtgtgtgaaatgtgttgc |
33419027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University