View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16521_low_99 (Length: 208)

Name: NF16521_low_99
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16521_low_99
NF16521_low_99
[»] chr2 (1 HSPs)
chr2 (7-193)||(33419027-33419213)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 193
Target Start/End: Complemental strand, 33419213 - 33419027
Alignment:
7 ggattgactccgcaaacgagtggcggagactggtcggagcttgaggccggtgtatggaggaaacgtggcagtgctccggcgagaagaggcgacgatagga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
33419213 ggattgactccgcaaacgagtggcggagactggtcggagcttgaggccggtgtatggaggaaacgtggcagtgctccggcgagaagaagcgacgatagga 33419114  T
107 gagcgaataagggagaaggattcgagttgtacggtggccatgattgcagaaaatcgtagctctggaaaagggtgtgaaatgtgttgc 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||    
33419113 gagcgaataagggagaaggattcgagttgtacggtggccatgattgcagagaatcgtagctctggaaaagtgtgtgaaatgtgttgc 33419027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University