View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16522_high_3 (Length: 240)
Name: NF16522_high_3
Description: NF16522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16522_high_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 45043243 - 45043023
Alignment:
| Q |
17 |
agtaggatgatcttttatctcgttttaattatttccccttttaggaaaattttgattagagatcccttctttt-atctggggannnnnnnnagcttggat |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
45043243 |
agtaggatgatcttttatctcgtttta----tttccccttttaggaaaattttgattagagatcccttttttttatctggggattttttttagcttggat |
45043148 |
T |
 |
| Q |
116 |
gttgaactactatattgttttctcataataatattagtatcttatttgatacaatatttaatttcccttttcggttagcatatcaattggcattaatttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45043147 |
gttgaactactatattgttttctcataataatattagtatcttatttgatacaatatttaatttccctttttggttagcatatcaattggcattaatttc |
45043048 |
T |
 |
| Q |
216 |
ctttgcctatccatcataactttgt |
240 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
45043047 |
ctttgcctctccatcataactttgt |
45043023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University