View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16522_low_4 (Length: 226)
Name: NF16522_low_4
Description: NF16522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16522_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 37 - 192
Target Start/End: Original strand, 40892812 - 40892962
Alignment:
| Q |
37 |
gacaaacattcttgagaattcatgaaacgataatgtttctatagatttgtttcaatctttcatggacataacataacttcttcaccttaaacttttatca |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40892812 |
gacaaacattcttgagaattcatgaaacgttaatgtttctatagatttgtttcaatctttcatggacataat-----ttcttcaccttaaacttttatca |
40892906 |
T |
 |
| Q |
137 |
gaaatgctaatggtgtcacattaaaaatgaaaattacatgtatgtcatttttattt |
192 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40892907 |
gaaatgctaacggtgtcacattaaaaatgaaaattacatgtctgtcatttttattt |
40892962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University