View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16523_high_15 (Length: 214)
Name: NF16523_high_15
Description: NF16523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16523_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 199
Target Start/End: Original strand, 35250437 - 35250613
Alignment:
| Q |
23 |
atatccatatatctttttctccagagtgcctgtcgtttcttgggcggtagaaactgatcatcaatggaagatgggagcgcatgccgtttcttgggtggta |
122 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35250437 |
atatccatatatctttttctccagagcgcctgccgtttcttgggcggtagaaactgatcatcaatggaagatgggagcgcatgccgtttcttgggtggta |
35250536 |
T |
 |
| Q |
123 |
gaaactgatcctcaatggaagatggtgctgcagttggtgtgttagtaataccgttttgagagtgacacctcttatgt |
199 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35250537 |
gaaactgatcatcaatggaagacggtgctgtagttggtgtgttagtaataccgttttgagagtgacacctcttatgt |
35250613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 132
Target Start/End: Complemental strand, 27780761 - 27780727
Alignment:
| Q |
98 |
agcgcatgccgtttcttgggtggtagaaactgatc |
132 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27780761 |
agcgcctgccgtttcttgggtggtagaaactgatc |
27780727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University