View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16523_low_18 (Length: 207)
Name: NF16523_low_18
Description: NF16523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16523_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 66 - 171
Target Start/End: Complemental strand, 21239778 - 21239675
Alignment:
| Q |
66 |
tggaatgcacactctcactagaaattgagcaaaaaattttgctcaatttctagtcaatgacaagagtgctcacaatagagtgacacttgtgttttattta |
165 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21239778 |
tggaatgcacactc--actagaaattgagcaaaaagttttgctcaatttctaatcaatgacaagagtgctcacaatagagtgacacttgtgttttatttt |
21239681 |
T |
|
| Q |
166 |
taatgt |
171 |
Q |
| |
|
|||||| |
|
|
| T |
21239680 |
taatgt |
21239675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 46034886 - 46034819
Alignment:
| Q |
1 |
cagctagatttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttgatgg |
68 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46034886 |
cagccagatttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttcatgg |
46034819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 39488757 - 39488697
Alignment:
| Q |
8 |
atttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttgatgg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39488757 |
atttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttcatgg |
39488697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University