View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16524_high_23 (Length: 318)
Name: NF16524_high_23
Description: NF16524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16524_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 17 - 299
Target Start/End: Complemental strand, 43663763 - 43663481
Alignment:
| Q |
17 |
acaattgaccaagtgtgacaacatgtatgtgtagatgattgtctctgttctgagtggaccatgggatgctctgtttggaggtggtaacctaccagctttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43663763 |
acaattgaccaagtgtgacaacatgtatgtgtagatgattgtctctgttctgagtggaccatgggatgctctgtttggaggtggtaacctgccagctttt |
43663664 |
T |
 |
| Q |
117 |
gtggtgggtgccgtggcggcgctagcaagtggcatattatccgtagtcttacttccatctccaccaccagatttggccaagtctgtaaccgctacaggag |
216 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43663663 |
gtggtgggtgccgtggcggctctagcaagtggcatattatccgtagtcttacttccatctccaccaccagacttggccaagtctgtaaccgctacaggag |
43663564 |
T |
 |
| Q |
217 |
gaggctttcattaaacagtgtggaacattttcttcatgtgtctatcttttttgtcccacgttttaatatggaagaagggaaag |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43663563 |
gaggctttcattaaacagtgtggaacattttcttcatgtgtctatcttttttgtcccacgttttaatatggaagaagggaaag |
43663481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University