View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16524_high_25 (Length: 304)
Name: NF16524_high_25
Description: NF16524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16524_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 293
Target Start/End: Original strand, 120961 - 121231
Alignment:
| Q |
18 |
atttcacggttcgaaaactaaattttattgcaacttttgtttcaattattaccaaattattgagtatcacaaaatagtacacgtgaaagcaatagtatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120961 |
atttcacggttcgaaaactaaattttattgcaacttttgtttcaattattaccaaattattgagtatcacaaaatagtacacgtgaaagcaatagtatga |
121060 |
T |
 |
| Q |
118 |
ctatgaacataaaatgtgtatgc-ttgattacttatgtacaatgtaatattattattactacgtagcaaataatgtttcaagagcnnnnnnnnnnnnnga |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
121061 |
ctatgaacataaaatgtgtatgctttgattacttatgtacaatgtaatattattattactacgtagcaaataatgtttcaagagc------atatataga |
121154 |
T |
 |
| Q |
217 |
ggaataattattgtttgtgttgaaatttgaaataggaggatgatttagcgggcgacctggaatggctttccaatatt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121155 |
ggaataattattgtttgtgttgaaatttgaaataggaggatgatttagcgggcgacctggaatggctttccaatatt |
121231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University