View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16524_high_28 (Length: 275)
Name: NF16524_high_28
Description: NF16524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16524_high_28 |
 |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0219 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 22 - 263
Target Start/End: Complemental strand, 8754 - 8513
Alignment:
| Q |
22 |
aacacgtgtgcggaaaaattagctaattttgattttcaaataattgatttagtttggtaggttttgttaccaatgtgcatcaaagaaggatactctagaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8754 |
aacacgtgtgcggaaaaattagctaattttgattttcaaataattgatttagtttggtaggttttgttaccaatgtgcatcaaagaaggatactctagaa |
8655 |
T |
 |
| Q |
122 |
atagatcgagtctatttaattattgattgaaatgatgattttgagtttggtcttgttgctagttgtgttgtataaaaccacactttgttttccttcacca |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8654 |
atagaccgagtctatttaattattgattgaaatgatgattttgagtttggtcttgttgctagttgtgttgtataaaaccacactttgttttccttcacca |
8555 |
T |
 |
| Q |
222 |
tgttttcttgataaggttttggtttagtaccctctagatatt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8554 |
tgttttcttgataaggttttggtttagtaccctctagatatt |
8513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University