View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16524_high_30 (Length: 262)
Name: NF16524_high_30
Description: NF16524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16524_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 3 - 192
Target Start/End: Complemental strand, 9586785 - 9586594
Alignment:
| Q |
3 |
aactataaattagggatggtaagagccaactcatctctgctcgtcaataacccgtttaaaaa-gtgtg-agtgggggtggtccaactagagatgtagggt |
100 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9586785 |
aactataaattaaggatggcaagagccaactcgtctctgctcgtcaataacccgtttaaaaatgtgtggagtgggggtggtccaactagagatgtagggt |
9586686 |
T |
|
| Q |
101 |
tgaaaatctcacttcaatccattttatagtagactgacgtgttggtaggttgacaagtcaatgnnnnnnnnaattattaattaaaacttcac |
192 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
9586685 |
tgaaaatctcactccaatccattttatagtagactgacgggttggtaggttgacgagtcaatgttttttttaattattaattaaaacttcac |
9586594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 83 - 112
Target Start/End: Complemental strand, 12502800 - 12502771
Alignment:
| Q |
83 |
caactagagatgtagggttgaaaatctcac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12502800 |
caactagagatgtagggttgaaaatctcac |
12502771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University