View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16524_high_32 (Length: 252)
Name: NF16524_high_32
Description: NF16524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16524_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 19 - 144
Target Start/End: Complemental strand, 43333099 - 43332974
Alignment:
| Q |
19 |
ttttatcatccaccgatgaaagtcattgtttagggccgtagatgaagtaataaaaccacccagacttatacaccgtaaaattctagatttggatatgagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43333099 |
ttttatcatccaccgatgaaagtcattgtttagggccgtagatgaagtaataaaaccacccagacttatacaccgtaaaattctagatttggatatgagt |
43333000 |
T |
|
| Q |
119 |
aagggtgtctagtctagcctagcaat |
144 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
43332999 |
aaaggtgtctagtctagcctagcaat |
43332974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University