View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16524_high_32 (Length: 252)

Name: NF16524_high_32
Description: NF16524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16524_high_32
NF16524_high_32
[»] chr2 (1 HSPs)
chr2 (19-144)||(43332974-43333099)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 19 - 144
Target Start/End: Complemental strand, 43333099 - 43332974
Alignment:
19 ttttatcatccaccgatgaaagtcattgtttagggccgtagatgaagtaataaaaccacccagacttatacaccgtaaaattctagatttggatatgagt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43333099 ttttatcatccaccgatgaaagtcattgtttagggccgtagatgaagtaataaaaccacccagacttatacaccgtaaaattctagatttggatatgagt 43333000  T
119 aagggtgtctagtctagcctagcaat 144  Q
    || |||||||||||||||||||||||    
43332999 aaaggtgtctagtctagcctagcaat 43332974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University