View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16524_high_35 (Length: 242)
Name: NF16524_high_35
Description: NF16524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16524_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 31398898 - 31399124
Alignment:
| Q |
1 |
ttcttatataaacacatttcaggtcttgacgtgattcgtaccgataggacactggttttttatgagaagaaagagaatttgtcaaaattatgggatattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31398898 |
ttcttatataaacacatttcaggtcttgacgtgattcgtaccgataggacactggttttttatgagaagaaagagaatttgtcaaaattatgggatattc |
31398997 |
T |
|
| Q |
101 |
ttgctgtttatgctaggatagataatgatgttggctatggtcaagg-tagtcattagatatgtgattcatttgaatgt--aannnnnnnnngttgcctct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
31398998 |
ttgctgtttatgctaggatagataatgatgttggctatggtcaaggttagtcattagatatgtgattcatttgaatgttaattttttttttgttgcctct |
31399097 |
T |
|
| Q |
198 |
tttcgacattgactaatacttggtcat |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31399098 |
tttcgacattgactaatacttggtcat |
31399124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 17 - 147
Target Start/End: Complemental strand, 34941625 - 34941495
Alignment:
| Q |
17 |
tttcaggtcttgacgtgattcgtaccgataggacactggttttttatgagaagaaagagaatttgtcaaaattatgggatattcttgctgtttatgctag |
116 |
Q |
| |
|
||||||||||||||||| |||| || ||||| ||| |||||||||||||||| |||| || |||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
34941625 |
tttcaggtcttgacgtggttcgcactgatagaacattggttttttatgagaaacaagaaaacttgtcaaaattatgggatattcttgcggtttatgcttg |
34941526 |
T |
|
| Q |
117 |
gatagataatgatgttggctatggtcaaggt |
147 |
Q |
| |
|
||||||||| || ||||| || ||||||||| |
|
|
| T |
34941525 |
gatagataaagaagttggatacggtcaaggt |
34941495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University