View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16526_low_12 (Length: 214)
Name: NF16526_low_12
Description: NF16526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16526_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 36285817 - 36285632
Alignment:
| Q |
19 |
ttccaagaaatcaaatctctaagaggcattttaccaaacagtgctcttgcagggttgatcaaatccaactccaaagacatgggaattgtgaactgttgag |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36285817 |
ttccaagaaatcaaatctctaacaggcattttaccaaacactgctcttgcagggttgatcaaatccaactccaaagacatgggaattgtgaactgttgag |
36285718 |
T |
 |
| Q |
119 |
ttggtgaccaagggtctgtctagaatgacttatttgagcatttctaagagacagtttgggaaaacttataacaattttcacaggtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36285717 |
ttggtgaccaagggtctgtctagaatgacttatttgagcatttctaagagactgtttgggaaaacttataacaattttcacaggtt |
36285632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University