View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16526_low_9 (Length: 233)
Name: NF16526_low_9
Description: NF16526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16526_low_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 24545094 - 24544862
Alignment:
| Q |
1 |
taatatgtgatgagcacatcaaaatgaatgttctgaaatacctacttggctcctgttatatttccaatctctaacaacctgaatcctactgcaaaatgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24545094 |
taatatgtgatgagcacatcaaaatgaatgttctgaaatacctacttggctcctgttatatttccaatctctaacaatttgaatcctactgcaaaatgat |
24544995 |
T |
|
| Q |
101 |
ctcactctatatctcaagtcagtgagttgcattctaagagctgcaaaactgaactcggggatctttcccatatataaactttttcataactcataaaccg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
24544994 |
ctcactctatatctcaagtcagtgagttgcattctaagagctgcaaaactgaactcggggatctttctcatatataaacttttccagaactcataaaccg |
24544895 |
T |
|
| Q |
201 |
tacctgggtgaggatacgaataaattccaaatt |
233 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24544894 |
tacctgggtgaggctacgaataaattccaaatt |
24544862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University