View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16527_high_2 (Length: 640)
Name: NF16527_high_2
Description: NF16527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16527_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 2e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 518 - 622
Target Start/End: Complemental strand, 39145191 - 39145087
Alignment:
| Q |
518 |
agtacgacgctgcatattgaaatacttgagaattacaagttcttgcatagatgaaaatatgtgttcgttaaagtgatgagctgagtgatgaataagaaga |
617 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39145191 |
agtacgacgctgcatattgaaatgcttgagaattacaagttcctgcatagatgaaaatatgtgttcgttaaagtgatgagctgagtgatgaataagaaga |
39145092 |
T |
 |
| Q |
618 |
atctt |
622 |
Q |
| |
|
||||| |
|
|
| T |
39145091 |
atctt |
39145087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University