View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16527_high_23 (Length: 215)
Name: NF16527_high_23
Description: NF16527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16527_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 47079569 - 47079751
Alignment:
| Q |
15 |
aagaatcaaaaacacacaatatttagtccaaaatttgaaatattggtgtaaacatttgcaaaataatctgtatcagcagtaacggtgataacgatgatga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47079569 |
aagaatcaaaaacacacaatatttagtccaaaatttaaaatattggtgtaaacatttgcaaaacaatctgtatcagcagtaacagtgataacgatgatga |
47079668 |
T |
 |
| Q |
115 |
tgaattagaaatggttggtacctcaacttgcgtgaacaatggttgaaaaccttgagcagtgtagaagaaatcgactgcgtcat |
197 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
47079669 |
tgaattagaaatggttggtacctcaacatgcgtgaacaatggttgaaaaccttgagcggtgtagaagaaatcgacggcgtcat |
47079751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 18227928 - 18227880
Alignment:
| Q |
149 |
aacaatggttgaaaaccttgagcagtgtagaagaaatcgactgcgtcat |
197 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||| || ||||||| |
|
|
| T |
18227928 |
aacaatggctgaaaaccttgcgcggtgtagaagaaatcaacggcgtcat |
18227880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University