View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16527_low_12 (Length: 439)
Name: NF16527_low_12
Description: NF16527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16527_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 7e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 15 - 181
Target Start/End: Original strand, 46273268 - 46273434
Alignment:
| Q |
15 |
actaccatcacacaacatcactccatatattataatttacaaaccaaactttactagagaattgagatgtaaaagataaataactagatagatttttgtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46273268 |
actaccatcacacaacatcactccatatattacaatttacaaaccaaactttactagagaattgagatgtaaaagataaataactagatagatttttgtt |
46273367 |
T |
 |
| Q |
115 |
gatggaatgactatatagaaaagaatatgcagaggcatcactaatactatagaggatgtgatgtttg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46273368 |
gatggaatgactatatagaaaagaatatgcagaggcatcactaatactatagaggatgtgatgtttg |
46273434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University