View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16527_low_25 (Length: 260)
Name: NF16527_low_25
Description: NF16527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16527_low_25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 260
Target Start/End: Original strand, 46925829 - 46926092
Alignment:
| Q |
14 |
gcagagacatttgatgtgttaggacgcgagttcgaacctaaaatttaatcatggcagtgaggatatttatttaaaagaaaaagatataaagaaaacaagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46925829 |
gcagagacatttgatgtgttaggacgtgagttcgaacctaaaatttaatcatggcagtgaggatatttatttaaaagaaaaagatagaaagaaaacaagt |
46925928 |
T |
 |
| Q |
114 |
aaatgattcggggactttatttgctgaagtga-----------------cttaaagaatttactagaagactcagtctattcacatatatgtagtatatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46925929 |
aaatgattcggggactttatttgctgaagtgatttaggttttgaattggcttaaagaatttactagaagactcagtctattcacatatatgtagtatatg |
46926028 |
T |
 |
| Q |
197 |
tttttctttcttcaaaatagtcaacattaatttgatttgaacctacattgtggaagtttatgcc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46926029 |
tttttctttcttcaaaatagtcaacattaatttgatttgaacctacattgtggaagtttatgcc |
46926092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University