View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16527_low_26 (Length: 248)
Name: NF16527_low_26
Description: NF16527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16527_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 13713488 - 13713702
Alignment:
| Q |
13 |
gagatgaaatactataattacaacagtaattcatgtgctgctggttatcagtgtggacattatactcaagttgtctggcgcgattcggttcgggttggat |
112 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13713488 |
gagaagaagtactataattacaacagtaattcatgtgctgttggttatcagtgtggacattatactcaagttgtctggcgcgattcggttcgggttggat |
13713587 |
T |
 |
| Q |
113 |
gtgctaaggtaaagtgtaatgatggccgtagcaccattattagttgtaactatgatccacctggtaattatattggtcagaggccttttaatattagtcc |
212 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13713588 |
gtgctaaggttaagtgtaatgatggtcgtagcaccattattagttgtaactatgatccacctggtaattatattggtcagaggccttttgatattagtcc |
13713687 |
T |
 |
| Q |
213 |
ttttgaagtgccatt |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13713688 |
ttttgaagtgccatt |
13713702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University