View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16527_low_27 (Length: 243)
Name: NF16527_low_27
Description: NF16527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16527_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 42862534 - 42862756
Alignment:
| Q |
19 |
tcgtcatggtatgaatatgattcataaacaccatgctttgctcttttacccttcacaacaaatatcttactccctctgttttcttttctatcatgtttcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42862534 |
tcgtcatggtatgaatatgattcataaacaccatgctttgctcttttacccttcacaacaaatatcttactccctctgttttcttttctatgatgtttcc |
42862633 |
T |
 |
| Q |
119 |
ttttgcactcccttctccaccatgtgggatttggcttttgttttacaaatcctttgataggtgtttgttttaatagcacaaattgtttttaacatgtttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42862634 |
ttttgcactcccttctccaccatgtgggatttggcttttgttttacaaatcctttgataggtgtttgttttaatagcacaaattgtttttaacatgtttg |
42862733 |
T |
 |
| Q |
219 |
tgttgccattgaaaattatgctt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42862734 |
tgttgccattgaaaattatgctt |
42862756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University