View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16528_high_14 (Length: 295)
Name: NF16528_high_14
Description: NF16528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16528_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 285
Target Start/End: Complemental strand, 40104682 - 40104415
Alignment:
| Q |
18 |
gattgtttgtgggagcatgatctaactcttgagacttcgaattctttttcaccggagagaaaatgaaagtgatcgaatataacttgcatgtatcaggatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40104682 |
gattgtttgtgggagcatgatctaactcttgagacttcgaattctttttgaccggagagaaaatgaaagtgatcgaatataacttgcatgtatcgggatc |
40104583 |
T |
|
| Q |
118 |
gtgttagtgtgtgtctaacacactttttgtcaaagacaatatgttttccattttggggctacatcttttagtcttagtgagtctctgaatccaattcacc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40104582 |
gtgttagtgtgtgtctaacacactttttgtcaaagacaatatgttttcccttttggggctacatcttttagtcttagtgagtctctgaatccaattcacc |
40104483 |
T |
|
| Q |
218 |
gaaattttgttacaaattaatgatactgagaattttcgctatgtcaacataggtatcattggcctttg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40104482 |
gaaattttgttacaaattaatgatactgagaattttcgctatgtcaacataggtatcattggcctttg |
40104415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University