View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16528_high_15 (Length: 283)
Name: NF16528_high_15
Description: NF16528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16528_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 37106928 - 37106676
Alignment:
| Q |
10 |
aacaaaattgcatactaagccagcccctttcatggcagcattttcatccaaaggaccaaatactattatacctgagattctaaaggtgttaatcattatc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37106928 |
aacaaaattgcatactaagccagcccctttcatggcagcattttcctccaaaggaccaaatactattatacctgagattctaaaggtgttaatcattatc |
37106829 |
T |
 |
| Q |
110 |
agacaccnnnnnnntgtttttccccttataatctattgtcatgtcatgtgtttgatatataacaaatctttgttaattttcagcctgatatcactgcacc |
209 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37106828 |
agacaccaaaaaaatgtttttcctcttataatctattgtcatgt-----gtttgatatataacaaatctttgttaattttcagcctgatatcactgcacc |
37106734 |
T |
 |
| Q |
210 |
aggagtgtcggttatagcagcctacactgaagctgaagggccaactaatcaagagttt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37106733 |
aggagtgtcggttatagcagcctacactgaagctgaagggccaactaatcaagagttt |
37106676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University