View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16528_high_7 (Length: 510)
Name: NF16528_high_7
Description: NF16528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16528_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 9e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 9e-99
Query Start/End: Original strand, 263 - 494
Target Start/End: Complemental strand, 56162199 - 56161956
Alignment:
| Q |
263 |
ataaattaagagactggactaacaaaatatgataacgaatctatggagatggttagggtttcaaactccaatagaaatgaagagcttataacaaaaagtc |
362 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56162199 |
ataaattatgagactggactaacaaaatatgataatgaatctatagagatggttaagttttcaaactccaatagaaatgaagagcttataacaaaaagtc |
56162100 |
T |
 |
| Q |
363 |
caatat------------gtattttgtccagctaatgttttagaccaagattattgtcgatcttaaatgcaaaattgaaaatgtatttagtccaacctgg |
450 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56162099 |
caatataaatgtgaatatgtattttgtccagctaatgttttagaccaagattattgtcgatcttaaatgcaaaattgaaaatgtatttagtccaacctgg |
56162000 |
T |
 |
| Q |
451 |
aaatttaaaaatatctatgatttgtaagaaattacaggtgttga |
494 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56161999 |
aaatttaaaaatatctatgatttgtaagaaattacaggtgttga |
56161956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 119
Target Start/End: Original strand, 49445919 - 49445967
Alignment:
| Q |
71 |
cagaactcatatctcattgtctagctataatgctcatgattcgggtaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
49445919 |
cagaactcatatctcattgtctagctacactgctcatgattcaggtaaa |
49445967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University