View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16529_low_7 (Length: 208)
Name: NF16529_low_7
Description: NF16529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16529_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 11 - 195
Target Start/End: Complemental strand, 42635912 - 42635728
Alignment:
| Q |
11 |
gcacagaaacaggagaccgcatataataataatttaagaaaaataaaagtgattttatacaatacgtgtcagtgttggatcctgacttgtgtcaggctcc |
110 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42635912 |
gcacagaaacaagagaccgcacataataataatttaagaaaaataaaagtgattttatacaatatgtgtcagtgttggatactgacttgtgtcaggctcc |
42635813 |
T |
|
| Q |
111 |
agatgcatcttcaatatgaagtactccagacgcattttcaatatgaagtgtctatgctacataatctttaggaggtggtaagtga |
195 |
Q |
| |
|
||| |||||||||||||||||| ||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42635812 |
agacgcatcttcaatatgaagtgctctagacgcatcttcagtatgaagtgtctatgctacataatctttaggaggtggtaagtga |
42635728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 36 - 113
Target Start/End: Original strand, 7228342 - 7228417
Alignment:
| Q |
36 |
ataataatttaagaaaaataaaagtgattttatacaatacgtgtcagtgttggatcctgac-ttgtgtcaggctccaga |
113 |
Q |
| |
|
||||||||||||||||| | |||||||||| | |||| ||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
7228342 |
ataataatttaagaaaa-tgaaagtgatttagtgcaat--gtgtcagtgttggatactgactttgtgtcaggctccaga |
7228417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University